🇵🇪🤝 Perú: Así fue el PRIMER DEBATE presidencial entre Pedro Castillo y Keiko Fujimori (COMPLETO)

Los candidatos Keiko Fujimori (Fuerza Popular) y Pedro Castillo (Perú Libre) tuvieron el primer encuentro de cara a la segunda vuelta electoral. El debate se realizó en la Plaza de Armas de Chota, en Cajamarca.



SUSCRÍBETE ► ow.ly/Uzfi3
Web: www.rpp.pe
Facebook: rppnoticias?...
Twitter: RPPNoticias
Instagram: rppnoticias

. La voz del Perú. Noticias del Perú y el mundo, las 24 horas del día.

Commenti

  • Gerardo Palacios
    Gerardo Palacios23 ore fa

    Hola soy de México Y una pregunta por qué los candidatos usan la playera de la selección, o los colores de la selección

  • J. Emilio Robles Reales
    J. Emilio Robles RealesGiorno fa

    A Sra. Fujimori jamás gustó Chota.

  • galo manuel calva freire
    galo manuel calva freireGiorno fa

    Mire Ushted, yo le digo a ushted metashe en politica de shu paish, esh como shi un peruano she metiera en política eshpañola....esh como decir que el Cholo Berrocal she pushiera a cantar Paquito el Chocolatero, entienda ushted

  • galo manuel calva freire
    galo manuel calva freireGiorno fa

    Que dices si tú pais es japon...vienes a decir que eres peruana por donde solo a los ingenuos convences

  • jacobbs salinas
    jacobbs salinasGiorno fa

    No Perú. no sean argentina y Venezuela, el estado se mete en todo y solo da pobreza, las empresas se van y solo queda desempleados, después van a tener su plata a mismo valor al peso argentino. Saludos de argentina

  • Félix Antonio Caro Lopez
    Félix Antonio Caro Lopez2 giorni fa

    Gracias a Fujimori se debe el promgueso q a tenido el

  • Nuri Riep
    Nuri Riep2 giorni fa

    Burra corrupta.

  • Mesmel Ramirez
    Mesmel Ramirez2 giorni fa

    La regla general debe ser el respeto a todas las personas comprometidas en una polémica y no quedar como alguien prepotente como lo está haciendo la señora Fujimori.

  • Gabriel Bunay
    Gabriel Bunay2 giorni fa

    Los que estan detras te las camaras no se si son family de la Fujimori o estan cobrando para ponerse parte de ese partido de mier*$*#&da

  • Violeta Alvarado
    Violeta Alvarado2 giorni fa

    Lambiendo los zapatos los periodistas de fugimoriy bravo Pedra presidente

  • vera
    vera3 giorni fa

    Tanto habla de terrorismo esa señora pues ni el uno ni el otro ni terrorismo ni a ti te queremos.

  • oigreser1
    oigreser13 giorni fa

    Que asco, que as o de mujer, indignante. Que lastima que vote por cambio 90 en mi adolescencia. Pero ya no más!!!! Fuera y a la reja toda la familia Fujimori

  • Marioly Mercado
    Marioly Mercado3 giorni fa

    Ajaaa y q es una carcel pues 😂😂😋 si no un centro d rehabilitacion entre comillas

  • Pablo Mellognio Senior
    Pablo Mellognio Senior3 giorni fa

    Esa reaccionaria periodista que habla le besa el trasero a la hija de un LADRON como Fujimore padre!!!!!

  • HECTOR CAMPANA
    HECTOR CAMPANA4 giorni fa

    KEIKO .... DICE RESPETO PERO A PUNTE BALA COMO EL PAPA.

  • HECTOR CAMPANA
    HECTOR CAMPANA4 giorni fa

    KEIKO NO ME DA CONFIANSA...... PUEDE SER UNA TRAGEDIA PARA EL PERU.

  • Javier Castillo
    Javier Castillo4 giorni fa

    eso es imparcial? terrucos cobardes, solo saben utilizar machete... da promesas, pero no dice cómo lo hará, sin que le pregunten nada, ese tipo solo sabe esquivar las preguntas, cualquiera puede prometer, pero como!!! cínico, lo que quiere es quitar robar, expropiar, en fin es el camarada Castillo

  • Nuri Riep
    Nuri Riep4 giorni fa

    Que irresponsable esa ladrona corrupta.

  • Robin Hood
    Robin Hood5 giorni fa

    Su votan por Keiko significa que a los peruanos les gusta ser ROBADOS. NO APRENDIERON NADA DE LO QUE EL PILLO FUJIMORI LES. HIZO EN EL PASADO

  • Lidia Meraz
    Lidia Meraz5 giorni fa

    Está vieja 👵 es una grandísima estupida la vacuna es Gratis no porqué ella diga , porque así es mundialmente y está es puro Bla Bla , una persona como el maestro se nota a leguas qué quiere lo mejor!!! Desde Houston mexicana, está mujer hija de un infeliz , ademas ya no hay futuro, piensen cómo está el mundo, es bonito hablar y fácil, pero para cumplir está Cañón

  • Mauro Villagomez
    Mauro Villagomez5 giorni fa

    esto parecio un 4x4 de batalla de gallos por que lluvieron los vergazos

  • vanel va
    vanel va6 giorni fa

    Corrupta hablando de corrupcion

  • azucena huambi
    azucena huambi6 giorni fa

    4 debates para que solo para que la puchimori able pendejadas

  • Alejandro Rafael vasquez
    Alejandro Rafael vasquez6 giorni fa

    pedro.castilio.prrcidente

  • Miguel Marcelo
    Miguel Marcelo6 giorni fa

    Yo vivo en el. Extranjero y decepcionado de la política peruana no vote y ahora me arrepiento de no haber participado de éstas elecciones y de haber votado por Castillo, me quedó muy claro que algunos periodistas y medios de comunicación están vendidos y son vende patria. Le deseo el mejor de los éxitos y fuerza para nuestro presidente

  • Yyeve Valdivia
    Yyeve Valdivia6 giorni fa

    Por que se pone sombrero? Lima es costa no es Sierra..

  • Freddy Leon
    Freddy Leon7 giorni fa

    La reconciliación de los opuestos satisfase a la mente y al crazón esta pequeñés es un salto cuantico para estos dos ineptos

  • Jose Orlando Rojas Lopez
    Jose Orlando Rojas Lopez7 giorni fa

    Periodistas parcialidades estos Como les dolerá que gano Pedro

  • ivan contratista
    ivan contratista7 giorni fa

    La keiko Habla pura guea, va a las regiones a puro regalar..

  • ivan contratista
    ivan contratista7 giorni fa

    La keiko dice VA HACER 3.000. colegio. MI pregunta para que tanto si la gente se esta hiendo a chile y a otros paises..

  • ivan contratista
    ivan contratista7 giorni fa

    Peruanos hueones quieren a la Keiko como presidenta, no aprenden de los presidente que antenado. Ella misma dice cuando sea presidenta indultara a su padre, y ella ase poco le dieron prisión preventiva por corrupta.

  • Evelin Horna
    Evelin Horna8 giorni fa

    Eres el engendro de tu padre chuki

  • Evelin Horna
    Evelin Horna8 giorni fa

    Keiko quiere un cambio en sus bolsillos ladrona

  • Jorge Isaac Posso
    Jorge Isaac Posso8 giorni fa

    NO MAS RIQUEZAS PARA EL JAPON LA CORRUPCION COMO LE DUELE A LA CANDIDATA FUGIMORE

  • LUIS MONTENEGRO CARTER
    LUIS MONTENEGRO CARTER9 giorni fa

    Sácate el sombrero ignorante

  • Antonio Valdes
    Antonio Valdes9 giorni fa

    Tratar de que fujimore, llegué tarde, táctica de los comunistas

  • Norma Canales
    Norma Canales9 giorni fa

    ESTÁ BUENO ESTE DEBATE PÚBLICO CON MODERADORES IMPARCIALES !!!! NO CON PERIODISTAS MILITANTES DE MEDIOS DE DERECHA COMO EL QUE RELATA ....LAMENTABLE ......INÉDITO ESCUCHARLOS DECIR QUE ES UNA FALTA DE RESPETO NO ESPERARLA A KEIKO!!!!ES EL PAIS DEL REVÉS!!!!

  • Mariana Rojas
    Mariana Rojas9 giorni fa

    Keiko no es la solución para presidente del Perú, qué Diosito los libre y proteja

  • Socorro Gutierrez
    Socorro Gutierrez9 giorni fa

    T ttttttt[tttttttttttttttttttttttttttttttttttttttttttttttttttttt[tttttt[ttttttttttttttttttttttttttttttttttttttttttt[t[ttttttttt[ttttttt[tttttt[ttt[[[t[[ttttttttttttttttt[tttttttt[ttt[ttttt[ttttttttt[tttttttt[ttt[[tt[tttt[t=[ttt[tt[tt[tt[tttttttttt[ttt[tttttt[[tt[t[ttttt[[[t=[tt[[ttt[[tatto tttttttttttttttttttttttttttttttttttt[ttttttttttttttttttt[ttttttttttttttttttttttt[[tttttt[tttttttt[[[[tt[tttt[tt[=[[[tttt[tttt[[[tttt([t[t[[ttt[[ttttttttt[tttttttttttttttttttttttttttttt=ttttttttttttttttt[[tt[tttt[tt[[ttttttttt[tttt[ttt[t[[t[[[t[[t[t[[tttt[tttttt[t[[tt[tt[[t[t[tt[=[[t[tt[[[[[t[tt[=tt[ttttt[[[tt[tt[t[tttt[tttttttttttttttttttttttttttttttttttttt5tttttttttttt5tttttttttttttttttttt5ttttttttttttt[t[tttttttttt[[[tt[[ttttttttt[t[tttttttt[[t[tttttttttttttttttttttttt[ttttt[ttttt[ttttt[tttt[t[[ttttttt[[tttt[[t5tttttt[ttttttttttttttttttttttttt[ttttttttt[tttt[tttt[t[tttt[ttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt4ttttttttttttttttttttttt[tt[tttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt5ttttttttt[ttttttttttttttttttttttttttttttttttttttttttt[tttttt5tttttttttttttttttttttttttttttt[tttttt5ttttttttttttt[tttttttttttttttttttttttttttttttttttttttttcttttttttttttttttt[ttttt[ttttttttttttttttttttttttt=ttttttttttttttttttttttttt[[tt[ttttttttttttttttttttttttttttttttttttttttttttttttttttt[t[ttttt[tttttttttt[tttttttttttttttttttttttttttttttttttttttttttt[ttttttttttttttttt tttttttttttttttttttttttttttt5ttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt[tttttttt[tttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt5tttt[[ttt[t[t[ttttttttttttttcttttttttttttttttttttttt[tttttttttttttttttttttttttt[tttttttttttt[ttttt tttttttttttt65tttttttt[tttttttttttttttttttttttt[tt[ttttttttttctttt[ttttttttttttttt[tt[tttttttt[ttttttttttttttttttttttttttttttttt6ttttttttttttttttttttttt[ttttttttttttttttt5tttttttttttttt[tttttttttt[ttttttttttttt[6ttttttt[ttttttttttcttttttttttttttttttttttct5tttttttttttttttttttttt[ttttttttttttttttttcttt5tttttttttttttttttttttttttttttttttttttttttttttt[ttttctttttttttttttttt5tt5t tt5ttttttttttttt5ttt[t[t[tttttttttttttt tttttttt tttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt[ttttctttttttttttttttt5tt5t ttttttttttttttttt ttttttttttttttttt ttttttttttttttttt tttttttttttttttttttttttttttttttttt[tt[ttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt[tttttttttttttttttttttttttttttttttttt65tttttttttttttttt6tttttttttttttttt[tttttttttttttttttttttctttttttttrtttttttt5ttttttttttttt[tttttttttttttttttttt[t[tttt[ttttt[ttttttttt[tttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttctt5ttttttttttttttttt6tttttttttttttttttttftttttttttttttttttttttttttttttt[ttttt5[6tt[6[ttttttttttttttttttttttttttttttttttttttt5tttttttttttt[[tttttttt[ttttttttttttttttttttt[ttttttttttttttttttttttttttt[tttttt[ttttttttttttt[ttt[t[5ttt6[ttttttttttttttttt[tttttttt[tttttttttttttttttttttttttttttttttttttttttttt[tttttt[tttttttttttt[tttt[tttttttttttttttttttt5ttttttttttttt[ttttttttt[6ttc[tttttttttt[t5ttt[ttttttttttttttttttttttttttttttttttt5tttttttttttttttttttttttttttttttttttttt5tttttttttttttttttttttc[ttttttttttttttttttt6tttttttttttttttttt[[ttttttttttttttttttttttttt5ttttttttttttttttttttttttttttttttttttttttttttttt[tttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt6tttttttttttttttttttttttttttttttttttttttt5ttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt[tttttttttttttttttttttttttttttttt5ttttttttttttttttttt[tttttttttttttt6tttttttttttttttttttttttttttttttttttttttttttttt6ttttttttttttttttttt6ttttt5ttttttttttttttttttttttttt[tttttttttttttttttttttttttttttttttttttttttttttttttttttttt[tctttt[tttttttttttttttttttttttttt[tttt[tttttttttttt6tttttttttt5tttt6tttttttttttttttttttttttttt[tttttttttttttttttt[tttttttt[ttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt[ttttttttttttttttttttttttttttttttttttttt[ttttttttttttttttt t[[[tttttttttttttttttttttttttttttt[tt[ttttttt[t[tttttt[tttt[tttttttt[tt[tt[t[t[tt[[t[tt[ttt[[tttt[[t[ttttttttttttttttttttttttttttttttttttt[tttttt[t[t[t[[t[[[[t[[t[[[t[tt[[[tt[[tt[ttt[tt[[tttt[t[tttt[t[[t[t[ttttttttt[[tt[ttttt[[ttt[tt[[[t[[[t[[[[t[tt[t[[tttttttttt[tt[[[t[t[t[tt[ttt[tt[[ttt[[tt[[[[[[tt[[[[[[tt[[tt[[[[t[[[ttt[t[ttttttt[[tt[tt[tttt[t[t[[tt[ttt[ttttt[[[ttt[tt[t[tt[[tt[ttt[[t[ttt[tt[tt[ttttt[ttt[tt[t[[t[ttttt[ttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt[tttttttttttttttttttttttttttttttttttttttt[tttttttttttttttttttttttttttttt[tttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt[tttttt[ttt[tttt[tttt[[tt[t[[ttt[[[t[tttt[tt[tttt[ttttttttt[ttt[[[t[[[tt[t[[t[ttt[t[ttttttt[t[t[[t[ttt[tt[[[t[[[[[[t[[[t[t[tttt[t[t[ttttttt[[[ttttttt[[t[ttttt[[[t[tt[t[[t[tttt[ttttt[[[[t[tt[[tt[[[[[[[t[[t[[[[[t[[[[tt[t[t[[ttttttttttt[[t[[[t[[t[5t[t[[t[[ttt[t[[[t[[[[[[[[[tttt[tt[t[ttt[[[[[[[[t[[tttt[[[t[[t[[ttttt[[[tt[[tt[t[[tt[t[t[t[t[t[[[[[[[[[[t[t[t-ggc- gg g g-gcgg gcgggggggggggg ggggggg g gggggggcgcgcgggg-cggggggctcgggcgggcgc-cggc- gcg-gg g- gcggcgcgg g tgcgcggcgg t g - gg ggg-c-cggctgc-c-cgcggg gg- gc--c-cgcgcgcgcggggcgctcgcgggcg gctctcgcgcgct gg g tg g gg tcggggg tg gcgcgg tcggcgg ggcgcggcggcggctcgcgcggggcggcgggggggcgccg ggctcggggcggctctgcg- ggcg- gggcggctcggcggcgg tcg gccg-cggg gggg ggg-gcgggggggcg gcg tcgggg ggcgggg gggggggcgcggcg ggcgctcggggcgcgcg-cgc-g gggg gggcgg gcgcggg fue g-c-cgggggggggg gg gcggct ggcg ggctg gcgtggcgg gggg t gg-ggcgcggcgcgcggggcgcgcgcggcggggcggcggcgcg g gg-gggcgcgggcgggcggggcgcggg ggg g gcg gcgggggg ggcggct-gggcgggcggcggcggggcggggggcgcgggcgggcggc-gcgc[ctcggcggcggggcg- ggctgcgggcggcggcgcgggcgcggcgggcgcggggcggcg-c-cggcggggcgcgg t ggctcgcggct g g t ggctcggg tcggcggggg t tc-ggg-c--ggc--- gggg gcgct-cggcgc-g-c- ggcg-cgg ggcggcgcggcggctcgc--gc-cggcgg tcggctcgg-cgcg-cggcgcg g gg g - ggctgcg ggcg ggct no gg gg-g- gg-cgg g-g ggcggc-cggg gg-cgcgc-g-ggcg- g gcggggggcgcggcgc-cgcg cggggcgggcg- t tgggg ggcgg ggggggcggcggggggg ggc-gggggggg-cgcggggctc-cggcg-cggggcggggcgcgcgcgc-cg-cg g g ggcggcgcggc-c-c- g- ggc--g g-cgggcgggg-c--gcgctcgcggg - gcgggg- ggcggcgcgcggggggggcgcggcg-c--g g-gc--cgcg=ggggcgg-cgggcgg--g g g ggggcg-cgcg gg-g g - - c=-ggjgggc-cg-cgcg[c-cggcgcgg - g=ggg=gcgcggggcggggg--

  • Socorro Gutierrez

    Socorro Gutierrez

    9 giorni fa

    Fvffcv

  • Socorro Gutierrez

    Socorro Gutierrez

    9 giorni fa

    Tgggg

  • Socorro Gutierrez

    Socorro Gutierrez

    9 giorni fa

    Tffrrtffrr g-gcgtggcgg gg

  • Socorro Gutierrez

    Socorro Gutierrez

    9 giorni fa

    Gcgtggcgg - g g-gg

  • Socorro Gutierrez

    Socorro Gutierrez

    9 giorni fa

    Gcgtggcgg gcgtggcgg ggg

  • Noemi Zorrilla
    Noemi Zorrilla10 giorni fa

    Que horrible mujer

  • Analia Cruz
    Analia Cruz10 giorni fa

    VAMOS CASTILLO. KEIKO. CERRA EL PICO. LADRONA, INMORAL Y LO PEOR VAGA...VAGA..!!

  • Rodrigo Taco Sangucho
    Rodrigo Taco Sangucho10 giorni fa

    Que pena de la Fujimure, que able de migración, lo de Latinoamericanos, mos salido del país es, por lo que ay mucho corrupción, porque no ben los políticos en Europa, en Europa ay trabajo para cualquier países, eso deben de ver, todos los politicos de latino América, basta de políticos niolebirales. 🇸🇪👑👌🙏🙏🙏

  • dely Francisca Terrones mendoza
    dely Francisca Terrones mendoza10 giorni fa

    Hola 🙂🙂 ii

  • Ramona victoria Cedeno rizzo
    Ramona victoria Cedeno rizzo10 giorni fa

    peruanos no la Fujimori no se olviden del comportamiento del padre de la señora Fujimori ,yo suy ecuatoriana Saludos desde Génova Italia

  • Gabriela Santos
    Gabriela Santos10 giorni fa

    No entiendo cómo toooodooo el mundo llegó temprano y ella no pudo llegar a tiempo ... Es una falta de respeto !!!

  • charly garcia
    charly garcia10 giorni fa

    Peru de verdad que no tienen a nadie mas para postularse de candidatos que estos dos mequetrefes ? Un imitador de cantinflas lo haria mejor .

  • charly garcia
    charly garcia10 giorni fa

    Del peru se va a ir hasta el ceviche con este presidente ,preparense para lo que viene peruanos !

  • Nahúm Flores
    Nahúm Flores11 giorni fa

    Tiene pena la señora Fujimori después de todo lo que robó su padre como presidente, seguir en política para esta señora es un acto de cinismo!

  • Raquel Allende juarez
    Raquel Allende juarez11 giorni fa

    Buena Propuesta señor Castillo, sé que tiene la intención de hacer cambios positivos en la educación y en general. saludos desde Alemania

  • Maria Elena Ururi Calizaya
    Maria Elena Ururi Calizaya11 giorni fa

    Estos de Rppson unos corruptos

  • Guillermo Meza
    Guillermo Meza11 giorni fa

    Pésimo público, no saben respetar un debate.

  • Hiliana Granada
    Hiliana Granada11 giorni fa

    Keiko es una corrupta desde siempre. con sus mentiras indigna al peru, siempre para diciendo "hay si castillo gobernara a peru , el pollo subiria de presio" osea tiene tanto dinero hasta para hacer un anuncio en youtub y hacer sus caramelitos de "K" y aun asi con ese dinero nos compra a todos , dicen "No al comunismo arriba keiko" osea esa gente esta comprada, ya que para ella es puro dinero dinero dinero, corrupta sin verguenza

  • Anabel Avila
    Anabel Avila11 giorni fa

    Castillo presidente te apoio des de bolivia lá señora ya empeso mal Es falta de respeto al pueblo peruano

  • jose francisco fortuna rondon
    jose francisco fortuna rondon11 giorni fa

    el profesor apenas califica como ministro de educacion. siendo venevolo . no tiene capacidad politica .ni un apice..

  • Rene Lizarazu
    Rene Lizarazu12 giorni fa

    Jajajaj las mismas palabras de hugo chavez jajaja el tal socialista de sonbrero

  • cesar almeida
    cesar almeida12 giorni fa

    Mil respetos Sra Fujimori !

  • Elias Marcano
    Elias Marcano12 giorni fa

    La misma estrategia de los círculos bolivarianos del chavismo de Venezuela amenazando a los que se oponen a sus idiologia, eso se ve mal visto a nivel internacional, que gane el mejor o la mejor candidata, ya veremos lo que va a pasar en Perú, Dios quiera que tengan buena suerte, saludos a todos los peruanos.

  • Silvia Guzmán elias
    Silvia Guzmán elias12 giorni fa

    Ganó Pedro felitasiones

  • Guillermo Escobar
    Guillermo Escobar12 giorni fa

    No puedo creer que este señor Pedro Castillo sea la mejor opcion. Da verguenza. Me extraña que el pueblo Peruano, no busquen mejores representantes. Una lastima. Ojala no pase lo que paso en Bolivia, Venezuela y Argentina. Populistas que engañan con promesas de mejoras que nunca llegan. Keiko seria la mejor opcion.

  • elis de moreno
    elis de moreno13 giorni fa

    Por lo menos está preocupado por los maestros porque en venezuela somos indigentes

  • Splendida 777 Mady Arte
    Splendida 777 Mady Arte13 giorni fa

    La puntualidad descrive su personalidad. Como Aqui EN europa.yo cuando estaba EN Perù era asi Como ustedes... però cambie a mis 48 anos.ok!!!.fuerza Castillo cuidate.no sera facil gobernar El Perù...se mas fuerte q la mafia EN general.

  • el yi pelingue
    el yi pelingue14 giorni fa

    Jajjajajajajaja esa payasa keiko solo es una payasa .......sabias palabras de pedro castillo te aplaudo pedritoeres el mejor.

  • Rosemarie Martinez-Gertsch
    Rosemarie Martinez-Gertsch14 giorni fa

    QUE TODO SEA X EL BIEN DEL PERÚ.9

  • Rogelio Molina
    Rogelio Molina14 giorni fa

    Yo soy mexicano y a castillo se mérese una oportunidad, el partido de derecha ya gobernó demaciados años así como en mi país , sabemos todos cuáles son los resultados , aora es tiempo de darle la oportunidad a la izquierda y todo puede cambiar así como en mi hermos país , Arriva perú si se puede

  • Lucinda Bustamante julca
    Lucinda Bustamante julca15 giorni fa

    Jajaja eso es lo q sabe hacer la sra K ofrecer tablet computadoras, celulares eso se llama comprar voto

  • Lucinda Bustamante julca
    Lucinda Bustamante julca15 giorni fa

    Jajaja la cara de la sra K es tan actuado finjido soberbia como siempre.. promete y jamás cumple

  • Mónica Guzmán
    Mónica Guzmán15 giorni fa

    No soy Peruana, y me puse a ver el debate solo por gusto, y me dio la impresión de que los periodistas parecen comprados. Desde el principio lo percibí, por ejemplo, si el candidato Castillo hubiera llegado tarde, se lo hubieran acabado! Era lógico que había que estar presentes a una determinada hora, y rrspetarlo, si por alguna razón no podía llegar a tiempo, así lo hubiera manisfestado.

  • Leobardo Perez
    Leobardo Perez15 giorni fa

    Soy colombiano, y no entiendo como hay gente en Peru que quiere como presidente a una hija de Fujimori. La calidad del gobierno de papá Fujimori fue discutible para el Peru, para mi malo, pero como sea, la hija se ve mil veces peor y que solo está ahí por la corrupción en torno a su padre. De mal a peor?

  • Rosa S
    Rosa S15 giorni fa

    Castillo piensa arreglar los problemas quitandole dinero a los ricos para darselo a los pobres. Enseñale al pescador a pescar no le llenes su barca de peses

  • Victorino Perez
    Victorino Perez15 giorni fa

    WELCOME MR. CASTILLO TO THE PERUVIAN PRESIDENTIAL OFFICE

  • VERONICA CADILLO
    VERONICA CADILLO15 giorni fa

    DESPUÉS DE HABER ESCUCHADO ESTE DEBATE HE ACLARADO MIS DUDAS ...LOS PERIODISTAS Y DIVERSOS DIARIOS SE ENCARGARON DE EMBARRAR A UN CANDIDATO DE TILDARLO DE TERRUCO Y PEORES CONCEPTOS ....MUCHA GENTE HA OPTADO POR VOTAR POR EL MAL MENOR ESO ADUCÍAN ...Y ESTO FAVORECÍA A KEIKO ....AL FINAL SIEMPRE SON LAS ESTRATEGIAS SUCIAS PARTE DE UNA CAMPAÑA.......HASTA AHORA NO ASIMILO COMO KEIKO FUJIMORI HA PODIDO LLEGAR HASTA EL FINAL ...DEBERÍAN DE HABER LEYES QUE IMPIDEN LA PARTICIPACIÓN DE POLÍTICOS CORRUPTOS....

  • Inviens Vevo
    Inviens Vevo15 giorni fa

    Vamos keikooo

  • sara martinez
    sara martinez15 giorni fa

    Cuidado! Con el candidato del sendero luminoso. Esa es una lacra. Así mismo hablaba Hugo Chávez. Y mira cómo está ahora. Ese candidato no es más que un guerrillero. Habla mucha basura.

  • A. .J
    A. .J16 giorni fa

    Jajaja "el pueblo chotano"

  • parsifa lou
    parsifa lou16 giorni fa

    HA SIDO TU PADRE QUIEN VENDIO NUESTRAS EMPRESAS A CHILE, ERES CINICA Y TONTA. IGNORANTE COMO CASTILLO. ESTAMOS EN LA ORCA

  • parsifa lou
    parsifa lou16 giorni fa

    20 ANOS ATRAS TU PADRE CREO LA CRISIS EN PERU. ELIMINO Y VENDIO EMPRESAS Y GENTE PERUANA. EN JAPON NO LOS QUIEREN Y USTEDES SON CINICOS... CIERTO QUE CERRON HA HECHO DESASTRES EN EL VALLE DEL MANTARO. CONSTRUIR EDIFICIOS EN HUANCAYO???, DONDE LAS CALLES PRINCIPALES DE HYO. PARECEN UNA PROMISCUIDAD DE NECESIDAD. DONDE CERRON ERA TU AYAYERO DEVUELVE EL DINERO QUE TE HA HECHO ENGORDAR Y PAGAR LOS IGNORANTES POLITICOS QUE ROBO TU PADRE, DEVUELVE EL PERU Y SI NO LOS QUIEREN EN JAPON, BUSQUEN OTRO MODO DE POLITICA, PSEUDO POLITICA

  • parsifa lou
    parsifa lou16 giorni fa

    PARECE UNA FIESTA DE ANIVERSARIO..... DE LA POBREZA

  • Miri Pego
    Miri Pego16 giorni fa

    Hermanos Peruanos voten al mal menor a Keiko, si no caerán en la trampa del comunismo. DIOS🕆 Los Bendiga 🙏

  • Maria ARIAS MÉNDEZ

    Maria ARIAS MÉNDEZ

    15 giorni fa

    Claro apoyemos a kkkkkkkkkoo👏👏👏😌

  • Administration HiRise
    Administration HiRise17 giorni fa

    Ya Pedro Castillo ha mencionado varias veces cambiar la constitución.

  • Sonia Advincula
    Sonia Advincula17 giorni fa

    Bien keiko viva El Peru

  • Karrly Delgado de Atoche
    Karrly Delgado de Atoche17 giorni fa

    Castillo me suena como a Chavez, Dios les Bendiga Perú

  • JorgeBlack Reaper
    JorgeBlack Reaper18 giorni fa

    todos los peruanos presentes voten por Keiko quiero comer

  • Nga Bagxc
    Nga Bagxc18 giorni fa

    Buena keiko..AsiDe guerrera como siempre Sacaras adelante al Peru y a todos los Pobres del Peru..Vamos...keiko...

  • GregToyotaCars
    GregToyotaCars19 giorni fa

    FUJIMURI SE ESPECIALIZA EN MENTIR COMO TODOS LOS BANDIDOS Y TRAIDORES DEL PASADO !!! QUE PENA Y QUE VERGUENZA QUE ELLA ESTE HABRIENDO LA VOCA CONTAMINADA LLENA DE MENTIRAS Y TRAISON !!

  • Artolo Larianco Sifuentes
    Artolo Larianco Sifuentes19 giorni fa

    Es

  • GregToyotaCars
    GregToyotaCars19 giorni fa

    Que pena y vergüenza que los Bandidos y Traidores de la Latin America todavía están mintiendo al los Pueblos de Latin America ! Basta de bandidos y ratos Politicos Latinoamericanos !! Viva Peru and Castillo.!! Viva Latin America !!

  • Kinz
    Kinz19 giorni fa

    PERÚ LIBRE= MOVADEF(+240 MIEMBROS)=SENDERO LUMINOSO ⚠️ESTO NO ES POR KEIKO, ES POR EL PERÚ⚠️ NO MAS TERRORISMO pasa la voz

  • leysivalentina ruiz
    leysivalentina ruiz19 giorni fa

    Ahora ya nadie ofrece trabajo solo ofrecen bonus 😲😲

  • Fatima y Lucía Chiki CancionesTv
    Fatima y Lucía Chiki CancionesTv19 giorni fa

    Keiko presidenta del Perú vamos keiko

  • jose franco
    jose franco19 giorni fa

    Pedro Castillo un títere más de esa tonteria retrogrado del SSXXI. Los peruanos se juegan su destino este domingo 6 de Junio-2021, el cambio y progreso con la candidata Fujimori o, el camino a Venezuela con retroceso pobreza, hambre y miseria con Pedro Castillo.

  • Juan Viera Pulache
    Juan Viera Pulache19 giorni fa

    Que difrencia se ve, un hombre del pueblo, una mujer de la corrupcion, DIOS bendiga al Peru, el pueblo esta hastiado de la corrupcion.

  • Edith Poma Quispe
    Edith Poma Quispe20 giorni fa

    Que tal conducción de estos periodistas se nota a leguas su preferencia e imparcialidad. Que tal. Como antes todo comprado

  • Msximo Torrez
    Msximo Torrez20 giorni fa

    Este viejo es comuñanga peruano no sosialismo ni una galleta van a tener todo va ser del gobieno

  • Msximo Torrez
    Msximo Torrez20 giorni fa

    este fotito precidente huele a comunista eso k Caba de ablar lo escuchaba del dirtador Fidel Castro a todo los peruano le pido k poten por la libertad y la demografía no sosialismo no cumunismo eso es ambre miseria y no libertad miren a Cuba a Venezuela a Nicaragua a Corea del Norte a Rusia a China le pido a todo en el nombre de los cubano k emo tenido k a bandonar a Cuba la libertad la demograsia para todo los impresario y dueño de negocio no boten por los comunista miren como comenzó chabel y maduro los Castro no comunismo

  • Lokokeko Keko
    Lokokeko Keko20 giorni fa

    A pesar de la guerra sucia de los medios de comunicación corruptos basura y redes sociales mi voto es por convicción para Perú Libre con Pedro Castillo CARAJOOOOOO

  • Jesús CHV

    Jesús CHV

    17 giorni fa

    Bueno ve para mi país 🇨🇺 que ahí vas a estar feliz 🙃

  • Pedro Delgado
    Pedro Delgado20 giorni fa

    Una japonesa que prefirio a su padre que a su madre le creen??

  • Elizabeth Aurea Solis
    Elizabeth Aurea Solis20 giorni fa

    Todo en las manos de Dios 🙏

  • Mr Darkmen
    Mr Darkmen20 giorni fa

    32:22 yo me como el pan con matequilla, jamón y queso 😂

  • Isabel Vida
    Isabel Vida21 giorno fa

    Desde USA, admiro y amo a mi presidente Donald Trump, un valiente Patriota q vino a trabajar por todos y puso en su momento en su Lugar a algunas organizaciones corruptas q nos manejan!!! Ay q aburrido ese Show del Comunismo o Rusia como lo hacen en USA cuando Quieren asustar al Pueblo, ya es tecnica Baja y Antigua y la mayoria no lo cree, y menos si viene de la Prensa BASURA!!! Ya no se acuerdan cuando salian a marchar en contra d ellos 🙃 A mi no me manipula la Prensa mediatica, narcisista, manejada por la elite(global), y enemiga del pueblo👺👹👿$$, ellos son realmente Terrori$ta$ emocionales, etc... yo me baso en lo q se vive en vivo y en directo, osea la realidad, investigacion de todas las Fuentes incluyendo aquella info q esconde por conveniencia la tv, radio, prensa escrita y El internet (FB, ITwindow, Google,etc...) q ya ellos estan desapareceriendo, hay medios q sigo q no tienen cavida en ninguna prensa prostituta y Todo lo tienen archivado. Me baso en la Historia, criterio, justicia, Sociologia... "Sanando la corrupción, se Sana todas las enfermedades" "Las Escaleras se Barren de Arriba hacian Abajo" Keiko no tiene ninguna autoridad moral!!! hace poco tuvo mayoria en El congreso y Ella los dirijia y fue oposicion muy irresponsable donde destruían sin piedad el Perú.Todo lo q a Ella le rodea es corrupto y huele feísimo, Falsos religiosos bendicen con una mano y con la Otra destruyen, huelen a traicion (se lo hizo a su propia familia: Kenji, la Madre y hasta El dictador del Padre de Keiko fue regresado a la Carcel gracias a esta desalmada y sus borregos del congreso, y El pueblo traicionado también), huelen a calumnia, a mafia, a Narcotrafico, a asesinos, a terrori$mo, a saqueo $$ Al Pais, son Antipatriotas y son Dictadura Fujimoris🎭!!! muchos por motivos obvios prefieren olvidar la Historia del Perú pero otros tenemos memorial! La sicopata investigada x corrupcion y ya tambien encarcelada, La Primera Dama de la Dictadura del gobierno de su padre presidiario sera siempre una peligrosa y suicida opcion para El Perú y ella ni deberia de existir en la politica y el Pueblo Peruano deberia enterrarla ya!!!

Il prossimo